Demo Datasets

Publication: A blood based 12-miRNA signature of Alzheimer disease patients
Study Design: 38 Alzheimer Disease (AD) vs. 22 Control (C)
3' Adapter: TGGAATTCTCGGGTGCCAAGG (Illumina Truseq small RNA 3p adapter)
Sequence Repository: GEO SRA
FASTQ Download Regular compression (37,71 GB) and Oasis compression (0,33 GB)
sRNA Detection Output: Online and Download
DE Analysis Output: Online and Download
DE Analysis Output Covariates: Online and Download Download covariates tableFormula: ~ Gender + Age + Treatment
Classification Output: Online and Download
Publication: Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome
Study Design: 10 Involved Psoriasis Skin (PP) vs. 10 Normal Skin (NN)
3' Adapter: TCGTATGCCGTCTTCTGCTTG (Illumina v1.0 small RNA 3p adapter)
Sequence Repository: GEO SRA
FASTQ Download Regular compression (7,26 GB) and Oasis compression (0,19 GB)
sRNA Detection Output: Online and Download
DE Analysis Output: Online and Download
DE Analysis Output without outliers: Online and Download
Classification Output: Online and Download
Publication: Genome-wide microRNA expression analysis of clear cell renal cell carcinoma by next generation deep sequencing
Study Design: 11 Clear Cell Renal Cell Carcinoma (ccRCC) vs. 11 Non-tumoral Renal Cortex (NRC)
3' Adapter: CGCCTTGGCCGTACAGCAG (SOLiD small RNA 3' adapter)
Sequence Repository: GEO SRA
FASTQ Download Regular compression (1,9 GB) and Oasis compression (0,15 GB)
sRNA Detection Output: Online and Download
DE Analysis Output: Online and Download
Classification Output: Online and Download

Recent News

Oasis Compressor

API