Publication: |
A blood based 12-miRNA signature of Alzheimer disease patients |
Study Design: |
38 Alzheimer Disease (AD) vs. 22 Control (C) |
3' Adapter: |
TGGAATTCTCGGGTGCCAAGG (Illumina Truseq small RNA 3p adapter) |
Sequence Repository: |
GEO SRA |
FASTQ Download |
Regular compression (37,71 GB) and Oasis compression (0,33 GB) |
sRNA Detection Output: |
Online and Download |
DE Analysis Output: |
Online and Download |
DE Analysis Output Covariates: |
Online and Download |
Download covariates tableFormula: ~ Gender + Age + Treatment |
Classification Output: |
Online and Download |