| Publication: | A blood based 12-miRNA signature of Alzheimer disease patients | |
| Study Design: | 38 Alzheimer Disease (AD) vs. 22 Control (C) | |
| 3' Adapter: | TGGAATTCTCGGGTGCCAAGG (Illumina Truseq small RNA 3p adapter) | |
| Sequence Repository: | GEO SRA | |
| FASTQ Download | Regular compression (37,71 GB) and Oasis compression (0,33 GB) | |
| sRNA Detection Output: | Online and Download | |
| DE Analysis Output: | Online and Download | |
| DE Analysis Output Covariates: | Online and Download | Download covariates tableFormula: ~ Gender + Age + Treatment |
| Classification Output: | Online and Download |