| Measure | Value |
| Sample ID | SRR330913_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 17313708 |
| Number of trimmed reads | 15217473 (87.9%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2829190 2524266 |
| Average read length | 22.39 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 11960252 |
| Number of uniquely mapped reads | 8378260 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |