| Measure | Value |
| Sample ID | SRR330912_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 11396558 |
| Number of trimmed reads | 9282619 (81.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1659233 2377222 |
| Average read length | 21.975 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 7360103 |
| Number of uniquely mapped reads | 4118662 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |