| Measure | Value |
| Sample ID | SRR330911_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 14111920 |
| Number of trimmed reads | 10166494 (72.0%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 985699 4411648 |
| Average read length | 22.625 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 8714573 |
| Number of uniquely mapped reads | 5369540 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |