| Measure | Value |
| Sample ID | SRR330910_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 6509963 |
| Number of trimmed reads | 4783069 (73.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 478403 1930324 |
| Average read length | 21.895 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 4101236 |
| Number of uniquely mapped reads | 2630540 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |