| Measure | Value |
| Sample ID | SRR330909_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 2815217 |
| Number of trimmed reads | 2004371 (71.2%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 44771 910584 |
| Average read length | 21.91 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 1859862 |
| Number of uniquely mapped reads | 1083358 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |