| Measure | Value |
| Sample ID | SRR330908_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 20414741 |
| Number of trimmed reads | 14240338 (69.8%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2888575 6607001 |
| Average read length | 21.935 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 10919165 |
| Number of uniquely mapped reads | 6729003 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |