| Measure | Value |
| Sample ID | SRR330907_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 12495905 |
| Number of trimmed reads | 11748265 (94.0%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1855960 899440 |
| Average read length | 22.06 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 9740505 |
| Number of uniquely mapped reads | 6697607 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |