| Measure | Value |
| Sample ID | SRR330906_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 13603554 |
| Number of trimmed reads | 12143300 (89.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2239828 1725975 |
| Average read length | 22.415 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 9637751 |
| Number of uniquely mapped reads | 6436364 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |