| Measure | Value |
| Sample ID | SRR330905_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 13062096 |
| Number of trimmed reads | 12286884 (94.1%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 6298197 939257 |
| Average read length | 21.72 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 5824642 |
| Number of uniquely mapped reads | 2623593 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |