| Measure | Value |
| Sample ID | SRR330904_NN |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 15579483 |
| Number of trimmed reads | 13907819 (89.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2999356 2023980 |
| Average read length | 22.125 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 10556147 |
| Number of uniquely mapped reads | 5843788 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |