| Measure | Value |
| Sample ID | SRR330866_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 19806786 |
| Number of trimmed reads | 15870238 (80.1%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1781441 4586750 |
| Average read length | 22.76 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 13438595 |
| Number of uniquely mapped reads | 8700956 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |