| Measure | Value |
| Sample ID | SRR330865_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 21826381 |
| Number of trimmed reads | 17692291 (81.1%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2637921 5085992 |
| Average read length | 22.525 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 14102468 |
| Number of uniquely mapped reads | 10130418 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |