| Measure | Value |
| Sample ID | SRR330864_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 18798259 |
| Number of trimmed reads | 13544948 (72.1%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 3564759 6096694 |
| Average read length | 22.775 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 9136806 |
| Number of uniquely mapped reads | 5878601 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |