| Measure | Value |
| Sample ID | SRR330863_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 10890612 |
| Number of trimmed reads | 9695623 (89.0%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 894850 1675363 |
| Average read length | 22.055 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 8320399 |
| Number of uniquely mapped reads | 5952446 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |