| Measure | Value |
| Sample ID | SRR330862_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 10450125 |
| Number of trimmed reads | 8311796 (79.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2972617 2436520 |
| Average read length | 22.02 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 5040988 |
| Number of uniquely mapped reads | 3188224 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |