| Measure | Value |
| Sample ID | SRR330861_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 19748697 |
| Number of trimmed reads | 16365218 (82.9%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2435602 4271577 |
| Average read length | 22.305 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 13041518 |
| Number of uniquely mapped reads | 8826615 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |