| Measure | Value |
| Sample ID | SRR330860_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 8289696 |
| Number of trimmed reads | 8035804 (96.9%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 5675990 282432 |
| Average read length | 21.94 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 2331274 |
| Number of uniquely mapped reads | 892156 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |