| Measure | Value |
| Sample ID | SRR330859_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 11922572 |
| Number of trimmed reads | 10848530 (91.0%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 3699455 1468246 |
| Average read length | 22.075 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 6754871 |
| Number of uniquely mapped reads | 4479323 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |