| Measure | Value |
| Sample ID | SRR330858_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 8341507 |
| Number of trimmed reads | 7020467 (84.2%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 997425 1768223 |
| Average read length | 21.965 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 5575859 |
| Number of uniquely mapped reads | 4302754 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |