| Measure | Value |
| Sample ID | SRR330857_PP |
| Adapter sequence | TCGTATGCCGTCTTCTGCTTG |
| Initial number of reads | 2173425 |
| Number of trimmed reads | 1554315 (71.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 96418 738869 |
| Average read length | 22.255 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 1338138 |
| Number of uniquely mapped reads | 1001244 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |