| Measure | Value |
| Sample ID | SRR837506 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 24410969 |
| Number of trimmed reads | 16731644 (68.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 16675068 7679534 |
| Average read length | 19.13 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 56367 |
| Number of uniquely mapped reads | 10681 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |