| Measure | Value |
| Sample ID | SRR837505 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 19118751 |
| Number of trimmed reads | 14021962 (73.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2922270 5099349 |
| Average read length | 21.5 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 11097132 |
| Number of uniquely mapped reads | 6649801 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |