| Measure | Value |
| Sample ID | SRR837504 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 24538176 |
| Number of trimmed reads | 17585022 (71.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 800877 6955819 |
| Average read length | 21.695 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 16781480 |
| Number of uniquely mapped reads | 9962235 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |