| Measure | Value |
| Sample ID | SRR837503 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 9577133 |
| Number of trimmed reads | 9449990 (98.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 234679 139315 |
| Average read length | 23.7 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 9203139 |
| Number of uniquely mapped reads | 6179870 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |