| Measure | Value |
| Sample ID | SRR837502 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 8350094 |
| Number of trimmed reads | 8155776 (97.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 39622 203843 |
| Average read length | 23.78 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 8106629 |
| Number of uniquely mapped reads | 5370833 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |