| Measure | Value |
| Sample ID | SRR837501 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 3000344 |
| Number of trimmed reads | 2931562 (97.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 30378 72977 |
| Average read length | 23.83 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 2896989 |
| Number of uniquely mapped reads | 1720445 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |