| Measure | Value |
| Sample ID | SRR837500 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 47326355 |
| Number of trimmed reads | 45787641 (96.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 174981 1564922 |
| Average read length | 23.69 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 45586452 |
| Number of uniquely mapped reads | 32315765 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |