| Measure | Value |
| Sample ID | SRR837499 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 54615117 |
| Number of trimmed reads | 52958473 (97.0%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 245530 1691455 |
| Average read length | 23.73 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 52678132 |
| Number of uniquely mapped reads | 37235304 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |