| Measure | Value |
| Sample ID | SRR837498 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 8001605 |
| Number of trimmed reads | 7769332 (97.1%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 48939 235216 |
| Average read length | 23.67 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 7717450 |
| Number of uniquely mapped reads | 5170001 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |