| Measure | Value |
| Sample ID | SRR837497 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 5110079 |
| Number of trimmed reads | 4975067 (97.4%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 47336 144789 |
| Average read length | 23.695 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 4917954 |
| Number of uniquely mapped reads | 3319738 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |