| Measure | Value |
| Sample ID | SRR837496 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 11579347 |
| Number of trimmed reads | 11406923 (98.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 47957 205112 |
| Average read length | 23.81 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 11326278 |
| Number of uniquely mapped reads | 7315623 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |