| Measure | Value |
| Sample ID | SRR837495 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 22110393 |
| Number of trimmed reads | 21755353 (98.4%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 55211 386377 |
| Average read length | 23.8 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 21668805 |
| Number of uniquely mapped reads | 14624735 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |