| Measure | Value |
| Sample ID | SRR837494 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 11965509 |
| Number of trimmed reads | 11599139 (96.9%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 45587 369918 |
| Average read length | 23.7 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 11550004 |
| Number of uniquely mapped reads | 6364690 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |