| Measure | Value |
| Sample ID | SRR837493 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 10860517 |
| Number of trimmed reads | 10555160 (97.2%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 65157 310343 |
| Average read length | 23.78 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 10485017 |
| Number of uniquely mapped reads | 6073608 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |