| Measure | Value |
| Sample ID | SRR837492 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 15825116 |
| Number of trimmed reads | 15317782 (96.8%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 524569 513344 |
| Average read length | 23.49 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 14787203 |
| Number of uniquely mapped reads | 10606302 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |