| Measure | Value |
| Sample ID | SRR837491 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 21273016 |
| Number of trimmed reads | 20567171 (96.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 197508 719455 |
| Average read length | 23.595 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 20356053 |
| Number of uniquely mapped reads | 13811323 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |