| Measure | Value |
| Sample ID | SRR837490 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 25847730 |
| Number of trimmed reads | 24977038 (96.6%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 584984 879302 |
| Average read length | 23.565 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 24383444 |
| Number of uniquely mapped reads | 17689206 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |