| Measure | Value |
| Sample ID | SRR837489 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 21719583 |
| Number of trimmed reads | 20905176 (96.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 165274 825475 |
| Average read length | 23.615 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 20728834 |
| Number of uniquely mapped reads | 13908836 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |