| Measure | Value |
| Sample ID | SRR837488 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 13083728 |
| Number of trimmed reads | 12925313 (98.8%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 288490 163225 |
| Average read length | 23.445 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 12632013 |
| Number of uniquely mapped reads | 7269921 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |