| Measure | Value |
| Sample ID | SRR837487 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 17449322 |
| Number of trimmed reads | 17231440 (98.8%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 670086 227851 |
| Average read length | 23.31 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 16551385 |
| Number of uniquely mapped reads | 10144995 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |