| Measure | Value |
| Sample ID | SRR837486 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 13691485 |
| Number of trimmed reads | 13449091 (98.2%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2321696 255965 |
| Average read length | 23.195 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 11113824 |
| Number of uniquely mapped reads | 6310878 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |