| Measure | Value |
| Sample ID | SRR837485 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 18207737 |
| Number of trimmed reads | 17933764 (98.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1041937 286537 |
| Average read length | 23.32 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 16879263 |
| Number of uniquely mapped reads | 9722243 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |