| Measure | Value |
| Sample ID | SRR837484 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 17534233 |
| Number of trimmed reads | 17283725 (98.6%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 987203 258927 |
| Average read length | 23.23 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 16288103 |
| Number of uniquely mapped reads | 8858924 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |