| Measure | Value |
| Sample ID | SRR837483 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 16800317 |
| Number of trimmed reads | 16516531 (98.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2683975 311351 |
| Average read length | 23.425 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 13804991 |
| Number of uniquely mapped reads | 8115824 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |