| Measure | Value |
| Sample ID | SRR837482 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 7302846 |
| Number of trimmed reads | 7182636 (98.4%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 497231 136777 |
| Average read length | 23.575 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 6668838 |
| Number of uniquely mapped reads | 3989048 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |