| Measure | Value |
| Sample ID | SRR837481 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 17347475 |
| Number of trimmed reads | 17010231 (98.1%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 697153 369779 |
| Average read length | 23.56 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 16280543 |
| Number of uniquely mapped reads | 10173041 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |