| Measure | Value |
| Sample ID | SRR837480 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 15751089 |
| Number of trimmed reads | 15429066 (98.0%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 148486 369951 |
| Average read length | 23.83 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 15232652 |
| Number of uniquely mapped reads | 10773080 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |