| Measure | Value |
| Sample ID | SRR837478 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 22793574 |
| Number of trimmed reads | 22354000 (98.1%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 108008 491476 |
| Average read length | 23.79 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 22194090 |
| Number of uniquely mapped reads | 16035261 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |