| Measure | Value |
| Sample ID | SRR837477 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 19187157 |
| Number of trimmed reads | 18860879 (98.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 134354 408822 |
| Average read length | 23.825 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 18643981 |
| Number of uniquely mapped reads | 13314268 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |